empty plasmid pegfp-n2 Search Results


90
Shanghai GenePharma plasmids overexpressing yap and malat1 constructed in pegfp-n2
Artesunate-induced apoptosis in C918 cells is partially inhibited by <t>MALAT1</t> overexpression. (A) Expression levels of MALAT1 in C918 cells following treatment with artesunate. **P<0.01 and ***P<0.001 vs. 0 µM. (B) qPCR analysis of the relative MALAT1 levels following MALAT1 overexpression plasmid transfection. **P<0.01 vs. negative control. (C) Viability of C918 cells following transfection with a plasmid overexpressing MALAT1 . (D) Caspase-3 and caspase-9 activity in C918 cells following transfection. Analysis of (E) ROS levels and (F) LDH release in C918 cells following transfection with a MALAT1 overexpression plasmid. (G) ELISA of IL-1β and IL-18 levels in C918 cells transfected with a MALAT1 overexpression plasmid. (H) Western blotting images and quantified data of phosphorylated and total YAP in C918 cells following transfection with a MALAT1 overexpression plasmid. *P<0.05, **P<0.01 and ***P<0.001. MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; qPCR, quantitative PCR; ROS, reactive oxygen species; LDH, lactate dehydrogenase; YAP, yes-associated protein.
Plasmids Overexpressing Yap And Malat1 Constructed In Pegfp N2, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/si+malat1/pmc08228376-68-4-17
Average 90 stars, based on 1 article reviews
plasmids overexpressing yap and malat1 constructed in pegfp-n2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Addgene inc pegfp n2 2xnls rnaseh1 delta
Artesunate-induced apoptosis in C918 cells is partially inhibited by <t>MALAT1</t> overexpression. (A) Expression levels of MALAT1 in C918 cells following treatment with artesunate. **P<0.01 and ***P<0.001 vs. 0 µM. (B) qPCR analysis of the relative MALAT1 levels following MALAT1 overexpression plasmid transfection. **P<0.01 vs. negative control. (C) Viability of C918 cells following transfection with a plasmid overexpressing MALAT1 . (D) Caspase-3 and caspase-9 activity in C918 cells following transfection. Analysis of (E) ROS levels and (F) LDH release in C918 cells following transfection with a MALAT1 overexpression plasmid. (G) ELISA of IL-1β and IL-18 levels in C918 cells transfected with a MALAT1 overexpression plasmid. (H) Western blotting images and quantified data of phosphorylated and total YAP in C918 cells following transfection with a MALAT1 overexpression plasmid. *P<0.05, **P<0.01 and ***P<0.001. MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; qPCR, quantitative PCR; ROS, reactive oxygen species; LDH, lactate dehydrogenase; YAP, yes-associated protein.
Pegfp N2 2xnls Rnaseh1 Delta, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/DCT%2EVV%2EOrf39+(Plasmid+%2312727)/bio_rxiv__2025__01__22__634323-372-59-63
Average 86 stars, based on 1 article reviews
pegfp n2 2xnls rnaseh1 delta - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Promega pcineo
Artesunate-induced apoptosis in C918 cells is partially inhibited by <t>MALAT1</t> overexpression. (A) Expression levels of MALAT1 in C918 cells following treatment with artesunate. **P<0.01 and ***P<0.001 vs. 0 µM. (B) qPCR analysis of the relative MALAT1 levels following MALAT1 overexpression plasmid transfection. **P<0.01 vs. negative control. (C) Viability of C918 cells following transfection with a plasmid overexpressing MALAT1 . (D) Caspase-3 and caspase-9 activity in C918 cells following transfection. Analysis of (E) ROS levels and (F) LDH release in C918 cells following transfection with a MALAT1 overexpression plasmid. (G) ELISA of IL-1β and IL-18 levels in C918 cells transfected with a MALAT1 overexpression plasmid. (H) Western blotting images and quantified data of phosphorylated and total YAP in C918 cells following transfection with a MALAT1 overexpression plasmid. *P<0.05, **P<0.01 and ***P<0.001. MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; qPCR, quantitative PCR; ROS, reactive oxygen species; LDH, lactate dehydrogenase; YAP, yes-associated protein.
Pcineo, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pcineo/pm16902196-58-26-33
Average 90 stars, based on 1 article reviews
pcineo - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc d210n addgene 196703
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
D210n Addgene 196703, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pGC384+(Plasmid+%2319670)/bio_rxiv__2025__01__22__634323-372-69-70
Average 93 stars, based on 1 article reviews
d210n addgene 196703 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Genlantis inc phcmv3
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
Phcmv3, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/phcmv3/10__1074_slash_jbc__m115__692756-197-17-18
Average 90 stars, based on 1 article reviews
phcmv3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc wt addgene 196702
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
Wt Addgene 196702, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pGMCS-0X-P38-PanBmGFP+(Plasmid+%2327127)/bio_rxiv__2025__01__22__634323-372-62-63
Average 93 stars, based on 1 article reviews
wt addgene 196702 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Addgene inc plncx chick src
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
Plncx Chick Src, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pLNCX+chick+src+(Plasmid+%2313665)/bio_rxiv__2025__01__22__634323-372-29-37
Average 90 stars, based on 1 article reviews
plncx chick src - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc filippo giancotti
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
Filippo Giancotti, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pBabe+FAK-puro+(Plasmid+%2321155)/bio_rxiv__2025__01__22__634323-372-45-63
Average 93 stars, based on 1 article reviews
filippo giancotti - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

95
Addgene inc 40753 pgp cmv gcamp6s
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
40753 Pgp Cmv Gcamp6s, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pGP-CMV-GCaMP6s+(Plasmid+%2340753)/pmc08059074-752-23-14
Average 95 stars, based on 1 article reviews
40753 pgp cmv gcamp6s - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

94
Addgene inc 86849 pbob ef1 fastfucci puro
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
86849 Pbob Ef1 Fastfucci Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pBOB-EF1-FastFUCCI-Puro+(Plasmid+%2386849)/pmc08059074-752-28-14
Average 94 stars, based on 1 article reviews
86849 pbob ef1 fastfucci puro - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
tiangen biotech co plasmid extraction kit
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
Plasmid Extraction Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/Plasmid+DNA+Giga+Extraction+Kit/pmc05377580-151-37-40
Average 96 stars, based on 1 article reviews
plasmid extraction kit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Promega phrl-cmv renilla luciferase vector
a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead <t>D210N</t> RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.
Phrl Cmv Renilla Luciferase Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/empty+plasmid+pegfp-n2/pgl3+basic/pm16522681-311-36-43
Average 90 stars, based on 1 article reviews
phrl-cmv renilla luciferase vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Artesunate-induced apoptosis in C918 cells is partially inhibited by MALAT1 overexpression. (A) Expression levels of MALAT1 in C918 cells following treatment with artesunate. **P<0.01 and ***P<0.001 vs. 0 µM. (B) qPCR analysis of the relative MALAT1 levels following MALAT1 overexpression plasmid transfection. **P<0.01 vs. negative control. (C) Viability of C918 cells following transfection with a plasmid overexpressing MALAT1 . (D) Caspase-3 and caspase-9 activity in C918 cells following transfection. Analysis of (E) ROS levels and (F) LDH release in C918 cells following transfection with a MALAT1 overexpression plasmid. (G) ELISA of IL-1β and IL-18 levels in C918 cells transfected with a MALAT1 overexpression plasmid. (H) Western blotting images and quantified data of phosphorylated and total YAP in C918 cells following transfection with a MALAT1 overexpression plasmid. *P<0.05, **P<0.01 and ***P<0.001. MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; qPCR, quantitative PCR; ROS, reactive oxygen species; LDH, lactate dehydrogenase; YAP, yes-associated protein.

Journal: Oncology Letters

Article Title: Artesunate combined with verteporfin inhibits uveal melanoma by regulation of the MALAT1 /yes-associated protein signaling pathway

doi: 10.3892/ol.2021.12858

Figure Lengend Snippet: Artesunate-induced apoptosis in C918 cells is partially inhibited by MALAT1 overexpression. (A) Expression levels of MALAT1 in C918 cells following treatment with artesunate. **P<0.01 and ***P<0.001 vs. 0 µM. (B) qPCR analysis of the relative MALAT1 levels following MALAT1 overexpression plasmid transfection. **P<0.01 vs. negative control. (C) Viability of C918 cells following transfection with a plasmid overexpressing MALAT1 . (D) Caspase-3 and caspase-9 activity in C918 cells following transfection. Analysis of (E) ROS levels and (F) LDH release in C918 cells following transfection with a MALAT1 overexpression plasmid. (G) ELISA of IL-1β and IL-18 levels in C918 cells transfected with a MALAT1 overexpression plasmid. (H) Western blotting images and quantified data of phosphorylated and total YAP in C918 cells following transfection with a MALAT1 overexpression plasmid. *P<0.05, **P<0.01 and ***P<0.001. MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; qPCR, quantitative PCR; ROS, reactive oxygen species; LDH, lactate dehydrogenase; YAP, yes-associated protein.

Article Snippet: Plasmids overexpressing YAP and MALAT1 (constructed in pEGFP-N2) and negative controls (empty pEGFP-N2 vector) were synthesized by Shanghai GenePharma Co., Ltd..

Techniques: Over Expression, Expressing, Plasmid Preparation, Transfection, Negative Control, Activity Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Real-time Polymerase Chain Reaction

Schematic diagram of the molecular mechanism underlying MALAT1 -mediated inactivation of YAP signaling in the inhibition of uveal melanoma cell viability. YAP, yes-associated protein; MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; ROS, reactive oxygen species; LDH, lactate dehydrogenase.

Journal: Oncology Letters

Article Title: Artesunate combined with verteporfin inhibits uveal melanoma by regulation of the MALAT1 /yes-associated protein signaling pathway

doi: 10.3892/ol.2021.12858

Figure Lengend Snippet: Schematic diagram of the molecular mechanism underlying MALAT1 -mediated inactivation of YAP signaling in the inhibition of uveal melanoma cell viability. YAP, yes-associated protein; MALAT1 , metastasis-associated lung adenocarcinoma transcript 1; ROS, reactive oxygen species; LDH, lactate dehydrogenase.

Article Snippet: Plasmids overexpressing YAP and MALAT1 (constructed in pEGFP-N2) and negative controls (empty pEGFP-N2 vector) were synthesized by Shanghai GenePharma Co., Ltd..

Techniques: Inhibition

a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead D210N RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.

Journal: bioRxiv

Article Title: A novel DNA repair protein, N-Myc downstream regulated gene 1 (NDRG1), links stromal tumour microenvironment to chemoresistance

doi: 10.1101/2025.01.22.634323

Figure Lengend Snippet: a, Schematic for the sister fork symmetry analysis. Asymmetric sister forks show a ratio of a shorter IdU track to longer track <1, while symmetric forks show ratio ≈ 1. SW1990 CNTR, NDRG1 deficient and cells treated with 250nM BLU6340 were analysed for sister fork symmetry. 89 bidirectional forks were analysed for CNTR cells, 44 for NDRG1 deficient and 49 for BLU6340-treated cells, magenta lines represent median, Mann-Whitney test was used for significance. b, Schematic of the RNase H1 constructs used in the assays, WT-RNase H1 removes R-loops whereas the catalytically dead D210N RNase H1 is unable to do so. Replication fork progression was analysed using DNA fiber assays. SW1990 cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with constructs encoding WT-RNase H1 (RNH1) or the catalytically dead (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >300 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Fork dynamics were analysed using DNA fiber assays. SW1990 CNTR, NDRG1 KO, and H194A addback cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >150 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. d, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 was used to probe for RNA-DNA hybrids in fixed cells. e , Confocal images of SW1990 cells stained with GFP-dRNH1 (green) in CNTR, NDRG1 KO and rescue (WT, H194A) SW1990 cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of nuclear GFP-dRNase H1 in SW1990 cells from ( e ). At least 1500 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. g, GFP-dRNH1 nuclear intensity was analysed in SW1990 CNTR cells, cells with NDRG1 knockdown (siNDRG1), or after BLU6340 250nM 24h. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 1600 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies SW1990 CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 2100 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i, Confocal images of the transcription-replication conflicts (TRC) in SW1990 cells. Proximity ligation assay (PLA) between PCNA and RNA PolII (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. j, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNA PollI, imaged and TRC foci counts analysed by CellProfiler. At least 210 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. k, DNA fiber assay in SW1990 CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >275 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. l, Schematic of the proposed mechanism by which ECM proteins stimulate DNA repair and reduce R-loop formation via integrin-FAK-SRC-SGK1-NDRG1 pathway.

Article Snippet: The H194A mutation was introduced via site directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent Technologies) using the following sense and antisense oligonucleotides H194A-s CCGGACATGGTGGTGTCCGCCCTTTTTGGGAAGGAAGAAATG, H194A-as oligo CATTTCTTCCTTCCCAAAAAGGGCGGACACCACCATGTCCGG. pLNCX chick-SRC was a gift from Joan Brugge (Addgene #13665), pBabe FAK-puro was a gift from Filippo Giancotti (Addgene #21155), empty plasmids were used as control (pLNCX and pBABE puro). pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT) (Addgene #196702) and pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N) (Addgene #196703) were a gift from Karlene Cimprich .

Techniques: MANN-WHITNEY, Construct, Control, Transfection, Recombinant, Purification, Staining, Fluorescence, Knockdown, Positive Control, Proximity Ligation Assay, Blocking Assay, Expressing

a, Replication fork progression in AsPC was analysed using DNA fiber assays. AsPC cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with WT- RNase H1 (RNH1) or the catalytically dead RNase H1 (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >200 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. b, Fork dynamics were analysed as in ( a ) using DNA fiber assays. AsPC CNTR, NDRG1 KO and H194A cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >200 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 can be used to probe RNA-DNA hybrids in fixed cells. d, SW1990 and AsPC cells were treated with vehicle control (DMSO), 1µM gemcitabine or 0.5µM SN-38 for 24h and analysed for RNA-DNA hybrid accumulation (R-loops) using the immunofluorescent GFP-dRNH1. Images were acquired, and dRNH1 nuclear intensity was analysed using CellProfiler, >670 cells were analysed per condition, Mann–Whitney test was applied to test significance, magenta lines are median values. e, dRNH1 immunofluorescence in CNTR, NDRG1 KO and rescue (WT, H194A) AsPC cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of GFP-dRNase H1 in the nuclei of AsPC cells from (e). >950 cells were analysed per condition, Mann–Whitney test was applied to test significance, magenta lines are median values. g, GFP-dRNH1 nuclear intensity was analysed in AsPC CNTR cells, cells with NDRG1 knockdown (siNDRG1), or BLU6340 treatment. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 3000 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies AsPC CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 1900 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i , j S9.6 antibody that recognises RNA-DNA hybrids was used as an additional method to analyse R-loop formation in NDRG1-impaired cells. SW1990 and AsPC (either NDRG1 KO-rescue panel or cells with NDRG1 knockdown/treated with BLU6340) were stained with S9.6 antibody. Nuclear fluorescence intensity of S9.6 staining was measured in CellProfiler, magenta lines represent median values, Mann-Whitney test was used for significance. >300 cells (SW1990) and >775 cells (AsPC) were analysed per condition. k, Representative images of the transcription-replication conflicts (TRC) in AsPC cells. Proximity ligation assay (PLA) between PCNA and RNA Pol-II (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. l, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNAPII, imaged and TRC foci counts analysed by CellProfiler. At least 200 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. Note that KO and +H194A cells failed to resolve TRCs at the 10h timepoint. m, DNA fiber assay in AsPC CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >200 double-labelled fibers are shown in magenta. Mann– Whitney test was applied to test significance.

Journal: bioRxiv

Article Title: A novel DNA repair protein, N-Myc downstream regulated gene 1 (NDRG1), links stromal tumour microenvironment to chemoresistance

doi: 10.1101/2025.01.22.634323

Figure Lengend Snippet: a, Replication fork progression in AsPC was analysed using DNA fiber assays. AsPC cells were treated with vehicle control (DMSO) or 250nM BLU6340 and co-transfected with WT- RNase H1 (RNH1) or the catalytically dead RNase H1 (dRNH1). Cells were pulsed with IdU (20min) followed by CldU (40min). Median IdU track lengths (µm) of >200 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. b, Fork dynamics were analysed as in ( a ) using DNA fiber assays. AsPC CNTR, NDRG1 KO and H194A cells were used and transfected with either WT- RNH1 , or dead RNH1 (dRNH1). Median IdU track lengths (µm) of >200 double-labelled fibers are shown in magenta. Mann–Whitney test was applied to test significance. c, Schematic of the recombinant RNase H1 construct used for R-loop visualisation. The bacterial purified GFP-labelled catalytic dead (D210N) RNase H1 can be used to probe RNA-DNA hybrids in fixed cells. d, SW1990 and AsPC cells were treated with vehicle control (DMSO), 1µM gemcitabine or 0.5µM SN-38 for 24h and analysed for RNA-DNA hybrid accumulation (R-loops) using the immunofluorescent GFP-dRNH1. Images were acquired, and dRNH1 nuclear intensity was analysed using CellProfiler, >670 cells were analysed per condition, Mann–Whitney test was applied to test significance, magenta lines are median values. e, dRNH1 immunofluorescence in CNTR, NDRG1 KO and rescue (WT, H194A) AsPC cells. Scale bar: 20µm. f, Analysis of the fluorescence intensity of GFP-dRNase H1 in the nuclei of AsPC cells from (e). >950 cells were analysed per condition, Mann–Whitney test was applied to test significance, magenta lines are median values. g, GFP-dRNH1 nuclear intensity was analysed in AsPC CNTR cells, cells with NDRG1 knockdown (siNDRG1), or BLU6340 treatment. Knockdown of Senataxin (siSETX) was used a positive control to induce R-loops. At least 3000 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. h, To assess whether NDRG1 KO increases R-loop content in the presence of chemotherapies AsPC CNTR and KO cells were treated with 0.5µM gemcitabine (GEM) or 0.5 µM SN-38 for 24h and analysed for RNA-DNA hybrid formation by GFP-dRNH1 staining. At least 1900 nuclei were analysed per condition, magenta lines represent median, Mann-Whitney test was used for significance. i , j S9.6 antibody that recognises RNA-DNA hybrids was used as an additional method to analyse R-loop formation in NDRG1-impaired cells. SW1990 and AsPC (either NDRG1 KO-rescue panel or cells with NDRG1 knockdown/treated with BLU6340) were stained with S9.6 antibody. Nuclear fluorescence intensity of S9.6 staining was measured in CellProfiler, magenta lines represent median values, Mann-Whitney test was used for significance. >300 cells (SW1990) and >775 cells (AsPC) were analysed per condition. k, Representative images of the transcription-replication conflicts (TRC) in AsPC cells. Proximity ligation assay (PLA) between PCNA and RNA Pol-II (RNAPII) was performed in CNTR, NDRG1 KO and rescue (WT, H194A) cells. PLA foci between PCNA and RNAPII are shown in white. Cytokeratin (green) was used to visualize cell shape, Scale bar: 10µm. l, SW1990 CNTR, NDRG1 KO, and rescue (WT, H194A) cells were synchronized by double thymidine block at G1/S border and TRC formation was analysed at different time-points post dT release. TRC accumulation was also analysed in non-synchronized cells. TRCs were assessed by PLAs between PCNA and RNAPII, imaged and TRC foci counts analysed by CellProfiler. At least 200 nuclei per timepoint were analysed, magenta lines represent median, Mann-Whitney test was used for significance. At 6h all the lines had significant TRC load which were resolved in the CNTR and WT add-back cells at 10h timepoint. Note that KO and +H194A cells failed to resolve TRCs at the 10h timepoint. m, DNA fiber assay in AsPC CNTR, NDRG1 KO and H194A add-back cells in the presence of transcription inhibitors α-amanitin (10mg/ml) and flavopiridol (10µM). Transcription inhibitors reduce TRC conflicts, thus preventing R-loops accumulation and rescuing replication fork dynamics in NDRG1-deficient or H194A NDRG1 expressing cells. Cells were pulsed with CldU (20min) and IdU (40min). Median IdU track lengths (µm) of >200 double-labelled fibers are shown in magenta. Mann– Whitney test was applied to test significance.

Article Snippet: The H194A mutation was introduced via site directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit, Agilent Technologies) using the following sense and antisense oligonucleotides H194A-s CCGGACATGGTGGTGTCCGCCCTTTTTGGGAAGGAAGAAATG, H194A-as oligo CATTTCTTCCTTCCCAAAAAGGGCGGACACCACCATGTCCGG. pLNCX chick-SRC was a gift from Joan Brugge (Addgene #13665), pBabe FAK-puro was a gift from Filippo Giancotti (Addgene #21155), empty plasmids were used as control (pLNCX and pBABE puro). pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT) (Addgene #196702) and pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N) (Addgene #196703) were a gift from Karlene Cimprich .

Techniques: Control, Transfection, MANN-WHITNEY, Recombinant, Construct, Purification, Immunofluorescence, Fluorescence, Knockdown, Positive Control, Staining, Proximity Ligation Assay, Blocking Assay, Expressing